2 characterization of pulmonary nodules using dynamic contrast enhanced ct

Tài liệu Báo cáo khoa học: "Fast and Robust Part-of-Speech Tagging Using Dynamic Model Selection" pptx

Tài liệu Báo cáo khoa học: "Fast and Robust Part-of-Speech Tagging Using Dynamic Model Selection" pptx

Ngày tải lên : 19/02/2014, 19:20
... index of the current word, f : SW, m: LSW, p: POS, a: ambiguity class, c∗ : character sequence in wi (e.g., c:2 : the 1st and 2nd characters of wi , cn−1: : the n-1’th and n’th characters of wi ... accuracies of all tokens (in %) Models D and G indicate domain-specific and generalized models, respectively and Model S indicates the dynamic model selection approach “G over D” shows how often Model ... responsibility of the authors and does not necessarily represent the of cial views of the ONC References Hal Daume III 2007 Frustratingly Easy Domain Adaptation In Proceedings of the 45th Annual Meeting of...
  • 5
  • 455
  • 0
A COMPARATIVE STUDY OF THE DIAGNOSIS OF PULMONARY TUBERCULOSIS USING CONVENTIONAL TOOLS AND POLYMERASE CHAIN REACTION* pot

A COMPARATIVE STUDY OF THE DIAGNOSIS OF PULMONARY TUBERCULOSIS USING CONVENTIONAL TOOLS AND POLYMERASE CHAIN REACTION* pot

Ngày tải lên : 06/03/2014, 04:20
... reverse primers used were 5'-TCCGCTGCCAGTCGTCTTCC-3' and 5'-GTCCTCGCGAGTCTAGGCCA-3' Forty cycles of amplification were performed using an initial denaturation step of 95ºC for five minutes, followed ... available for comparison of the performance of the individual tests, an analysis of results was done using a variety of standards Efficiency of microscopy, culture and PCR in terms of sensitivity, specificity, ... evident from the fact that for every patient of tuberculosis who can be detected using microscopy, nine have to be screened using indirect methods due to the low sensitivity of microscopy17 This...
  • 8
  • 524
  • 0
Synthesis and characterization of silicon nanowires using tin catalyst for solar cells application

Synthesis and characterization of silicon nanowires using tin catalyst for solar cells application

Ngày tải lên : 16/03/2014, 15:12
... reflectance below 0.5% at λ b 700 nm [20] The difference of the reflectance might be the effect of synthesis conditions, such as thickness of metal film and SiH4 gas flow The reduction of reflectance ... Therefore, further reduction of the reflectance will be expected from the optimization of the synthesis conditions of SiNWs For analysis of the electrical properties, the I–V curve of the fabricated ... caused by the unconnected metal Ag contact between the SiNWs and neighboring SiNWs Moreover, it might be the effect of Fig (a) Schematic of the SiNWs solar cells FE-SEM images of the (b) as-synthesized...
  • 3
  • 805
  • 0
Báo cáo khoa học: "Genetic characterization of Barbari goats using microsatellite markers" docx

Báo cáo khoa học: "Genetic characterization of Barbari goats using microsatellite markers" docx

Ngày tải lên : 07/08/2014, 23:22
... concentration of approximately 20 to 50 ng of DNA per μl); pmol of each primer (Microsynth, Switzerland) (list of primers used are given in Table 1); 500 μM each of dNTPs (Sigma-Aldrich, USA); 0.7 unit of ... amplified PCR products were electrophoresed in 6% denaturing urea polyacrylamide gel at a constant voltage of 1,300 volts for a period of h depending upon the size of PCR products and silver stained ... results of the microsatellite analysis in terms of number Genetic characterization of Barbari goats 75 of alleles observed, alleles size, polymorphism information content and heterozygosity of Barbari...
  • 4
  • 248
  • 0
Báo cáo khoa học: " A case report of pseudoprogression followed by complete remission after proton-beam irradiation for a low-grade glioma in a teenager: the value of dynamic contrast-enhanced MRI" pptx

Báo cáo khoa học: " A case report of pseudoprogression followed by complete remission after proton-beam irradiation for a low-grade glioma in a teenager: the value of dynamic contrast-enhanced MRI" pptx

Ngày tải lên : 09/08/2014, 10:20
... permeability characteristics, as recently proposed for predicting risk of recurrence in adult lowgrade gliomas [10] In this case, the typical combination of a focused area of high permeability strictly superimposed ... tools as FDG-PET or MR spectroscopy (MRS) analyse level of Figure Nine months after irradiation: complete disappearance of the contrast enhancement (left) and no detectable Permeability (right) ... to the legend of figures and correction of the manuscript DD created and developed the software used to treat T2* acquisition and produce the images JLH supervised the irradiation of the patient...
  • 5
  • 425
  • 0
liquefaction mitigation of silty soils using dynamic compaction

liquefaction mitigation of silty soils using dynamic compaction

Ngày tải lên : 13/11/2014, 16:21
... 8.5 Effect of impact grid pattern …………………… ……………………… 139 8.6 Effect of impact print spacing S …………… …………………………… 143 8.7 Effect of number of impacts NI ………………………………… ……… 144 8.8 Effect of time ... ………….……………………… 127 8.2 Effect of initial density of deposit (pre-(Dr)eq) …………………….… … 132 8.3 Effect of deposit’s hydraulic conductivity (k) and fines content (FC) … 134 8.4 Effect of level of energy delivery ... impact c) Soil density profile d) Impact location … 236 Figure E-6 a) Pore pressure profile after impact No b) Pore pressure profile just before next impact c) Soil density profile d) Impact location...
  • 320
  • 248
  • 0
Synthesis and characterization of nanostructured materials using dispersion polymerization

Synthesis and characterization of nanostructured materials using dispersion polymerization

Ngày tải lên : 15/09/2015, 17:10
... mechanism of the PANI-CS nanoparticle41 2.3.3 Effect of reaction parameters on the size of PANI-CS nanoparticles… 47 2.3.4 Effect of reaction parameters on the colloidal stability of PANI-CS ... Formation Mechanism of PPy-CS nanoparticles….67 3.3.3 Effect of Reaction Parameters on the Size of PPy-CS Nanoparticles….73 3.3.4 Effect of Reaction Parameters on the Colloidal Stability of PPy-CS Dispersion………………………………………………………………74 ... of Ag: 20 ± nm)……………… 141 XVI Chapter Introduction 1.1 Overview of Nanostructured Materials Nanostructured materials have attracted great research interest and the technology of their production...
  • 187
  • 587
  • 0
4D non rigid registration of renal dynamic contrast enhanced MRI data

4D non rigid registration of renal dynamic contrast enhanced MRI data

Ngày tải lên : 15/09/2015, 22:34
... NON-RIGID REGISTRATION OF RENAL DYNAMIC CONTRAST ENHANCED MRI DATA FOO JIT SOON B.Eng (Hons.), NUS A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING DEPARTMENT OF ELECTRICAL AND COMPUTER ... magnitude of the reference image in the x and y directions, respectively Gx , Gy Edge magnitude of the floating image in the x and y directions, respectively Voxel position within an image Bp Set of ... column due to the effect of contrast agent Image registration is complex in nature, and the difficulty of image registration is increased further when dynamic contrast enhanced- magnetic resonance...
  • 101
  • 120
  • 0
Structural damage assessment of building structures using dynamic experimental data (p 1 8)

Structural damage assessment of building structures using dynamic experimental data (p 1 8)

Ngày tải lên : 17/06/2016, 14:10
... Damage index of numerical examples Storey number Classification Case Predicted value Actual value Case Predicted value Actual value Case Predicted value Actual value Case Predicted value Actual value ... index of ith storey, Ki, K*i is the contribution of the ith storey on the global stiffness matrix of the undamaged and damaged structure respectively, and NL is the number of elements of the structures ... building structures It is reasoned that this is perhaps due to restrictions on the experiment, incorrect method, and lack of inspection opportunity for the structures In addition, for the case of large-scale...
  • 8
  • 368
  • 0
Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx

Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx

Ngày tải lên : 14/02/2014, 03:20
... II melt of Form II Form I to Form II melt of Form II loss of water melt of Form I Form I to Form II melt of Form II loss of water melt of Form III melt of Form VI loss of water melt of amorphous ... loss of water melt of Form III? loss of water melt of Form III Form I to Form II melt of Form II loss of water melt of Form III Form I to Form II melt of Form II Form I to Form II melt of Form ... Form II melt of Form II melt of Form VI melt of Form VI Form I to Form II melt of Form II loss of water melt of Form VI loss of water melt of Form VI Table Summary of combined DSC/XRD data, suggested...
  • 16
  • 549
  • 0
Báo cáo y học: " Characterization of the bronchodilatory dose response to indacaterol in patients with chronic obstructive pulmonary disease using modelbased approaches" ppt

Báo cáo y học: " Characterization of the bronchodilatory dose response to indacaterol in patients with chronic obstructive pulmonary disease using modelbased approaches" ppt

Ngày tải lên : 12/08/2014, 13:22
... correlation of the observed responses, as well as covariate adjustments (effect of baseline FEV1 on E and E max, and effect of reversibility following administration of a short-acting b2-agonist ... and 96% of the model-predicted maximal effect, respectively (Table 2) This suggests that doses of 75 μg or less are on the steep part of the dose response, 150 μg is at the threshold of the plateau ... responses While the overall objective of the patient level analysis was also to characterize the dose response, it had the further aim of quantifying the impact of patient characteristics on dose response...
  • 9
  • 688
  • 0
Characterization of interfacial mechanical properties using wedge indentation method 2

Characterization of interfacial mechanical properties using wedge indentation method 2

Ngày tải lên : 11/09/2015, 09:56
... middle of th wedge im m he mpression), and the FE ESEM plane view (Fig.4.4(a)) sho only e ows a central cra at this lo ack oad Fig F 4.3: Cr ross-section views o 120° wedge indenta nal of ations ... oad Fig F 4.3: Cr ross-section views o 120° wedge indenta nal of ations on th MSQ/Si system he i using FIB: ( no interf u (a) facial crack; (b) – (d) in nterfacial cr rack propag gation [1] 68...
  • 2
  • 138
  • 0
Báo cáo y học: "Characterization of N200 and P300: Selected Studies of the Event-Related Potential Salil H. Patel 1 and Pierre N. Azzam 2"

Báo cáo y học: "Characterization of N200 and P300: Selected Studies of the Event-Related Potential Salil H. Patel 1 and Pierre N. Azzam 2"

Ngày tải lên : 02/11/2012, 11:08
... Broader Aspects of Environmental Interaction P300 amplitude may reflect filtering and constructive processes – cf., a study of suggestible subjects inducted into hypnotic states: subjects were prescribed ... theory; reflecting the concept that the P300 reflects activity of memory trace remodelling postdetection of a target stimulus [61] It should be noted that ERP latencies fall into two distinct categories: ... element of P300 activity Additionally, environmental triggers may allow for the broad-based alteration of P300 activation P300 activity is modulated by the internal physiologic state of subjects,...
  • 8
  • 563
  • 0
Sensory characterization of dry-cured ham using free-choice profiling

Sensory characterization of dry-cured ham using free-choice profiling

Ngày tải lên : 03/04/2013, 21:07
... the product To summarize, FCP offers the possibility of assisting the demands of marketing and product development teams who require information on target consumer’s perception of products, rather ... pastiness (feeling of paste detected in hams with a high proteolytic index), fibrousness (textural property characterized by the perception of the amount of muscle fibres detected during chewing) ... Sensory evaluation of food: Principals and practices New York: Chapman and Hall Macfie, H J., Bratchell, N., Greenhoff, H., & Vallis, L V (1989) Designs to balance the effect of order of presentation...
  • 8
  • 762
  • 3
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx

Ngày tải lên : 18/02/2014, 16:20
... (Fig 1C) Isoelectric focusing gave pI of 5.8, 5.7, 5.5 and 5.2 for the four isoforms respectively Secondary structure of the pulchellin isoforms and melting temperature CD-spectral analyses were ... far-UV CD spectra of the pulchellin isoforms suggest only subtle differences in the content of secondary structure, which was confirmed by the spectral deconvolution using cdpro software Thermal ... mixture of other isoforms (*), respectively, in the presence (lanes 2–5) or absence (lanes 6–9) of 2-mercaptoethanol (C) Elution profile of P III and P IV Chromatofocusing chromatography of the...
  • 12
  • 763
  • 0
Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Tài liệu Báo cáo khoa học: Tissue expression and biochemical characterization of human 2-amino 3-carboxymuconate 6-semialdehyde decarboxylase, a key enzyme in tryptophan catabolism pptx

Ngày tải lên : 19/02/2014, 02:20
... primer 1fw CGCTCGAGATGAAAATTGACATCCATA GTCAT 11rev AAAGCTGAGCTCCATTCAAATTGTTTT CTCTCAAG 4fw TTCTCGAGATGGGAAAGTCTTCAGAGT GGT ACMSD real-time PCR: primer and probe ⁄ 3fw TGGCCAGATCTAAAAAAGAGGT ... residues that directly coordinate to A B C Fig 10 Homology modeling of human ACMSD I Prediction of the human enzyme structure (right) was made on the base of the crystal structure analysis of P fluorescens ... sequence alignment of human and bacterial ACMSD and the comparison of their three-dimensional structures, the presence of the metallocofactor in the human enzyme can be reliably predicted Indeed, in...
  • 14
  • 601
  • 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Ngày tải lên : 19/02/2014, 06:20
... solutions [20] The use of high concentrations of a small organic alcohol will affect the solvent structure of the protein Studies quantifying the effects of MPD on protein structure have demonstrated ... CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢ For derivitization with TMR, a Gly-Gly-Cys sequence was introduced at the C-terminus using oligomers 5¢-CTGCTGTCTACCTTTGGAGGTTGCTGATCCGAA TTCGAG-3¢ ... Production of first generation adenovirus vectors: a review Gene Ther 7, 1707–1714 Amalfitano A & Parks RJ (2002) Separating fact from fiction: assessing the potential of modified adenovirus vectors...
  • 10
  • 647
  • 0
Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf

Tài liệu Báo cáo khóa học: Quantitative analysis, using MALDI-TOF mass spectrometry, of the N-terminal hydrolysis and cyclization reactions of the activation 2 process of onconase pdf

Ngày tải lên : 19/02/2014, 12:20
... determined by UV spectroscopy, using an extinction coefficient of 10 280 M)1Æcm)1 [22] AAP concentrations were also determined spectrophotometrically using an extinction coefficient of E1%1 cm ¼ 14.4, ... Characterization of the hydrolysis reaction Met1 removal The election of the buffer system was based on previous studies on AAP activity [23] and on the influence of ions in the cyclization reaction ... 801.60), and expressing it as the fraction of hydrolyzed (Met1)-ONC (M23L) Figure shows the results of the characterization of the hydrolysis reaction as a function of guanidinium chloride concentration...
  • 9
  • 704
  • 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Ngày tải lên : 20/02/2014, 11:20
... addition of a TPP-moiety has been used to drive the selective uptake of a wide variety of Ó FEBS 2003 Fig Selective uptake of mitoDC-81 by mitochondria and subsequent alkylation of mtDNA The uptake of ... response of the electrode was then calibrated by sequential additions of lM mitoDC-81, which showed the expected logarithmic response of the electrode to cation concentra- Results Synthesis of mitoDC-81 ... the vicinity of mtDNA with the resultant binding and selective alkylation leading to a depletion of mtDNA in intact cells (Fig 1) Here we report the synthesis and characterization of a novel mitochondria-targeted...
  • 10
  • 638
  • 0

Xem thêm